Skip to main content

Table 1 Gene function and primer sequences

From: Renal response to short- and long-term exercise in very-long-chain acyl-CoA dehydrogenase-deficient (VLCAD−/−) mice

Probe Forward 5' → 3' Reverse 5' → 3' GenBank
β-actin TAGGCACCAGGGTGTGATGG CTCCATGTCGTCCCAGTTGG NM_009606.2
β-oxidation   
MCAD GAAAGTTGCGGTGGCCTTGG AAGCACACATCATTGGCTGC NM_007382.4
LCAD GGGAAGAGCAAGCGTACTCC TCTGTCATGGCTATGGCACC NM_007381.3
AOX TGCCCAGGTGAGAAGCCTGACG TCAGACTGGCGCCTCACAGC NM_015729.2
Renal failure   
Ngal GTGGTACGTTGTGGGCCTGG TGGCCAGCCCTGGAGCTTGG NM_008491
KIM1 GTCAGCATCTCTAAGCGTGG GGCAGAAGGTCCCTCAGAGG NM_001166631
Ho1 ATTGAGCTGTTTGAGGAGCTGC CACTGCCACTGTTGCCAACAGG NM_010442.2
Lipogenesis   
SREBP-1c CAGCTCAGAGCCGTGGTGA TTGATAGAAGACCGGTAGCGC NM_01148
ACC1α TCAACAGGCTGAGCTTCACACG ACTGGTCATGATATCCTGCAGC NM_133360
FASN TCTGGAATCCGCACCGGCTACC TTCCCGGGTTGCCCTGTCAAGG NM_007988.3